FAQ

  1. What is the requirement for the plasmid?
  2. What tag can be introduced into gene?
  3. How long DNA fragment (bp) can be inserted/deleted/substituted?
  4. How powerful is GM Biosciences' innovative mutagenesis technique?
  5. How about the accuracy of mutagenesis reaction?
  6. What if a mutant plasmid contains error in its sequences?
  7. What is the sequence of a tag to be inserted into a gene or vector?
  8. How long is the turnaround time?
  9. What do we perform for a service? What does customer provide?
  10. How cost-effective is our service compared to commercial kit? 
1. What is the requirement for the plasmid?

We need 1ug of plasmid purified from Dam+ E.coli. Almost all of the commonly used E.coli strains (DH5a, TOP10, XL1-Blue....) are Dam+. 

Plasmid size should be less than 8kb. This size is limited by the capacity of the highest fidelity DNA polymerase. Successful PCR of >8kb template using current technique has to compromise the accuracy, which lead to unexpected erroneous mutations. Therefore, we don't recommend to introduce mutant into any plasmid longer than 8kb.

     

2. What tag can be introduced into gene?

Any tag shorter than 20aa can be introduced in a single reaction. Multiple reactions are needed for a fragment longer than 20aa. 

Most of commonly used tag, such as Flag, V5, 6His, Myc and HA, are shorter than 20aa and can be introduced into a gene or a vector. For example, a conjugated tag of Flag and Myc (totally 18aa) was successfully inserted into a gene in a single reaction. 

The tag (fragment) could be a signal peptide, nuclear localization signal, membrane targeting signal, peptidase cleavage site or even an protein domain. 

However, longer protein (tag) such as GFP, GST are too long to be inserted into gene by mutagenesis.

     

3. How long (bp) is the DNA fragment that can be inserted/deleted/ substituted?

Any DNA fragment <= 60bp can be inserted/deleted/substituted into any desired site of a plasmid (< 8kb) in one round of mutagenesis reaction. Multiple reactions are needed for a DNA fragment longer than 60bp.

     

4. How powerful is GM Biosciences' innovative mutagenesis technique?

Deletion, insertion and substitution of 60bp have been easily performed in a single reaction. This innovative and creative technique enables us the first company to offer services of long range mutagenesis, such as tag insertion, re-construct MCS. 

For example: 
  • a 60bp fragment in a 7.4kb plasmid was substituted by an integrated tag of Myc and Flag (totally 60bp) 
  • insertion of Myc and 6His tag, one RE site, one stop codon (totally 60bp) into MCS of pcDNA3.1, which changed it to pcDNA3.1/Myc-His A 
  • the MCS from pcDNA3.1 containing 9 new RE sites was inserted into pMSCVpuro 

     

5. How about the accuracy of mutagenesis reaction? 

The combination of highest fidelity DNA polymerase, limited number of PCR cycles and linear amplification ensures almost 100% accuracy of mutagenesis without additional unwanted mutation. 

The primers are designed to only copy the parental strand in each PCR cycle resulting in a linear amplification. In contrast, an exponential amplification is performed in a traditional PCR reaction because each daughter chain synthesized in previous cycle can be used as template for the following cycles, wherein erroneous mutations can be amplified and accumulated thereafter. 

     

6. What if a mutant plasmid contains error in its sequences?

100% satisfaction guarantee is our commitment to our customers. If you receive a plasmid from GM Biosciences with errors on its sequence such as additional erroneous mutation, we will correct the error with no additional charge.

When an error is reported, we will confirm the error by sequencing the original plasmid received from customer against the plasmid we delivered. If the error is from the original plasmid, we will charge $50 per DNA sequencing and a new order for correction is required. 

     

7. What is the sequence of a tag to be inserted into a gene or vector?

 Tag name

Amino acid
sequence
DNA sequence
   6His    HHHHHH   CACCACCACCACCACCAC
   Flag    DYKDDDDK   GACTACAAGGACGACGACGACAAG
   V5     GKPIPNPLLGLDST   GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG
   Myc     EQKLISEEDL    GAACAAAAACTTATTTCTGAAGAAGATCTG 
   HA     YPYDVPDYA     TACCCATACGACGTCCCAGACTACGCT
If the tag you want is not listed above, please provide sequences you want to insert.

     

8. How long is the turnaround time?

Generally 8-14 business days starting from the date we obtain the plasmids. 
Primer synthesis generally takes about 2~5 business days which accounts for the major part of time and is out of our control. Once we get the primers, we need 2~3 business days to perform reaction and 1~2 business days for sequencing, data analysis, sample delivery. 

For saving time, please submit your Order Form first so as to we will start to design and synthesize primer. During the time of primer synthesis (generally 2~5 business days), we are expecting to receive your plasmid DNA. 

     

9. What do we perform for a service? What does customer provide?

We perform
  --Design and synthesis of mutagenic primers
  --Perform mutagenesis reaction, transformation, clones culture
  --DNA preparation, sequence multiple clones to confirm the mutation
  --Shipping 1-5 microgram of purified plasmid, DNA sequencing data alignment result
  and sequencing primer 

Customer provides
  --One microgram of plasmid
  --Information of vector and target gene

     

10. How cost-effective is our service compared to commercial kit?

We can perform mutagenesis of long range DNA fragment (>30bp) in a single round reaction, which most of commercial kits fail. Even for mutagenesis of short DNA fragment, our service is much cheaper than commercial kit (Please click here to compare the cost in details).

     

Home      
Products     
Services     
Ordering